| Basic information from miRBase |
| hairpin accession number: MI0008759 |
| Located between position 25359468 and 25359578 on chromosome 22 strand - |
| Overlapping with sense strand of XM_001172350.1 (intron 1). |
| (Ensemble: ENSPTRT00000026526) |
| mature miRNAs for MI0008759: |
| ptr-miR-548j (MIMAT0008224): AAAAGTAATTGCGGTCTTTG |
| You can find this miRNA in ENTREZGENE: MIR548J (accession: 100316216) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |