| Basic information from miRBase |
| hairpin accession number: MI0008760 |
| Located between position 68574068 and 68574182 on chromosome 11 strand + |
| Overlapping with sense strand of XM_508612.2 (intron 1). |
| (Ensemble: ENSPTRT00000007465) |
| mature miRNAs for MI0008760: |
| ptr-miR-548k (MIMAT0008225): AAAAGTACTTGCGGATTTTGCT |
| You can find this miRNA in ENTREZGENE: MIR548K (accession: 100316345) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |