| Basic information from miRBase |
| hairpin accession number: MI0008761 |
| Located between position 92985816 and 92985900 on chromosome 11 strand - |
| Overlapping with sense strand of XM_001142498.1 (intron 10). |
| (Ensemble: ENSPTRT00000007807) |
| mature miRNAs for MI0008761: |
| ptr-miR-548l (MIMAT0008226): AAAAGTATTTGCGGGTTTTGTC |
| You can find this miRNA in ENTREZGENE: MIR548L (accession: 100316217) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |