| Basic information from miRBase |
| hairpin accession number: MI0011344 |
| Located between position 13698247 and 13698317 on chromosome 17 strand + |
| Overlapping with antisense strand of SMAD1_BOVIN (intron 4). |
| (Ensemble: ENSBTAT00000003668) |
| mature miRNAs for MI0011344: |
| bta-miR-2284g (MIMAT0011847): AAAAGTTCGTTCGGCTTTTT |
| You can find this miRNA in ENTREZGENE: MIR2284G (accession: 100313141) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |