| Basic information from miRBase |
| hairpin accession number: MI0011387 |
| Located between position 134784371 and 134784446 on chromosome 2 strand + |
| Overlapping with antisense strand of (intron 14). |
| (Ensemble: ENSBTAT00000021869) |
| mature miRNAs for MI0011387: |
| bta-miR-2284u (MIMAT0011895): AAAAGTTCGTTCGGTTTTTCT |
| You can find this miRNA in ENTREZGENE: MIR2284U (accession: 100313163) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |