| Basic information from miRBase |
| hairpin accession number: MI0011465 |
| Located between position 49007583 and 49007653 on chromosome 4 strand - |
| Overlapping with antisense strand of (intron 16). |
| (Ensemble: ENSBTAT00000046754) |
| mature miRNAs for MI0011465: |
| bta-miR-2284b (MIMAT0011983): AAAAGTTCGTTTGGTTTTTTC |
| You can find this miRNA in ENTREZGENE: MIR2284B (accession: 100313433) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |