| Basic information from miRBase |
| hairpin accession number: MI0011325 |
| Located between position 1781573 and 1781645 on chromosome Un.004.1 strand - |
| Overlapping with antisense strand of STAU2 (intron 8). |
| (Ensemble: ENSBTAT00000046802) |
| mature miRNAs for MI0011325: |
| bta-miR-2284l (MIMAT0011824): AAAAGTTGGTTCGGGTTTTT |
| You can find this miRNA in ENTREZGENE: MIR2284L (accession: 100313326) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |