| Basic information from miRBase |
| hairpin accession number: MI0011332 |
| Located between position 4699 and 4770 on chromosome Un.004.4928 strand - |
| Overlapping with sense strand of A5PJQ0_BOVIN (intron 1). |
| (Ensemble: ENSBTAT00000011940) |
| mature miRNAs for MI0011332: |
| bta-miR-2285b (MIMAT0011833): AAAATCTGAGTGAACTTTTTGG |
| You can find this miRNA in ENTREZGENE: MIR2285B (accession: 100313134) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |