miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0009849
Located between position 66012106 and 66012186 on chromosome 21 strand +
mature miRNAs for MI0009849:
         bta-miR-495 (MIMAT0009335): AAACAAACATGGTGCACTTCTT
You can find this miRNA in ENTREZGENE: MIR495 (accession: 100313382)

References
[1]Artzi S, Kiezun A, Shomron N, BMC Bioinformatics. 9:39(2008)., "miRNAminer: a tool for homologous microRNA gene search"
[2]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species"
[3]Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis"