Basic information from miRBase |
hairpin accession number: MI0008743 |
Located between position 101462515 and 101462591 on chromosome 14 strand + |
mature miRNAs for MI0008743: |
ptr-miR-543 (MIMAT0008215): AAACATTCGCGGTGCACTTCTT |
You can find this miRNA in ENTREZGENE: MIR543 (accession: 100316208) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |