| Basic information from miRBase |
| hairpin accession number: MI0011437 |
| Located between position 47602456 and 47602520 on chromosome 26 strand - |
| Overlapping with antisense strand of DOCK1 (intron 31). |
| (Ensemble: ENSBTAT00000032730) |
| mature miRNAs for MI0011437: |
| bta-miR-2285c (MIMAT0011950): AAACCTGAACAAACTTTTTGGC |
| You can find this miRNA in ENTREZGENE: MIR2285C (accession: 100313465) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |