| Basic information from miRBase |
| hairpin accession number: MI0012572 |
| Located between position 74792559 and 74792654 on chromosome 10 strand + |
| Overlapping with sense strand of (intron 2). |
| (Ensemble: ENSPTRT00000057701) |
| mature miRNAs for MI0012572: |
| ptr-miR-606 (MIMAT0012810): AAACTACTAAAAATCAAAGAT |
| You can find this miRNA in ENTREZGENE: MIR606 (accession: 100316513) |
| References |
| [1]Artzi S, Kiezun A, Shomron N, BMC Bioinformatics. 9:39(2008)., "miRNAminer: a tool for homologous microRNA gene search" |