| Basic information from miRBase |
| hairpin accession number: MI0017290 |
| Located between position 125834227 and 125834293 on chromosome 8 strand + |
| mature miRNAs for MI0017290: |
| hsa-miR-4662a-5p (MIMAT0019731): TTAGCCAATTGTCCATCTTTAG |
| hsa-miR-4662a-3p (MIMAT0019732): AAAGATAGACAATTGGCTAAAT |
| References |
| [1]Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" |