| Basic information from miRBase |
| hairpin accession number: MI0007794 |
| Located between position 59800483 and 59800569 on chromosome 19 strand + |
| mature miRNAs for MI0007794: |
| mml-miR-518f (MIMAT0006383): AAAGCGCTTCCCTTCAGAGGA |
| You can find this miRNA in ENTREZGENE: MIR518F (accession: 100315543) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |