Basic information from miRBase |
hairpin accession number: MI0008779 |
Located between position 238368218 and 238368311 on chromosome 2b strand + |
Overlapping with sense strand of XR_023684.1 (intron 8). |
(Ensemble: ENSPTRT00000048975) RefSeq_dna: RefSeq) |
mature miRNAs for MI0008779: |
ptr-miR-562 (MIMAT0008242): AAAGTAGCTGTACCATTTGC |
You can find this miRNA in ENTREZGENE: MIR562 (accession: 100316489) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |