| Basic information from miRBase |
| hairpin accession number: MI0015572 |
| Located between position 466265 and 466321 on chromosome scaffold_89 strand + |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSCINT00000002182) |
| mature miRNAs for MI0015572: |
| cin-miR-4021-5p (MIMAT0016535): GTACGTACGTCATAATAAAA |
| cin-miR-4021-3p (MIMAT0016536): AAAGTATTGTGACGTCGTTA |
| You can find this miRNA in ENTREZGENE: mir4021 (accession: 100499028) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |