| Basic information from miRBase |
| hairpin accession number: MI0015580 |
| Located between position 1295076 and 1295129 on chromosome 14q strand + |
| Overlapping with sense strand of (intron 20). |
| (Ensemble: ENSCINT00000008033) |
| mature miRNAs for MI0015580: |
| cin-miR-4029-5p (MIMAT0016547): AAAGTGCAACTGTGTAAACC |
| cin-miR-4029-3p (MIMAT0016548): GTTTACATTGCATGCACTTA |
| You can find this miRNA in ENTREZGENE: mir4029 (accession: 100498912) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |