| Basic information from miRBase |
| hairpin accession number: MI0015581 |
| Located between position 5430401 and 5430452 on chromosome 3q strand - |
| Overlapping with sense strand of (intron 15). |
| (Ensemble: ENSCINT00000009715) |
| mature miRNAs for MI0015581: |
| cin-miR-4030-5p (MIMAT0016549): AAAGTGCAACTTTGATAGTG |
| cin-miR-4030-3p (MIMAT0016550): CGCTATCAGATGTGCTCTTA |
| You can find this miRNA in ENTREZGENE: mir4030 (accession: 100499061) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |