Basic information from miRBase |
hairpin accession number: MI0008642 |
Located between position 59466880 and 59466945 on chromosome 19 strand + |
mature miRNAs for MI0008642: |
ptr-miR-372 (MIMAT0008122): AAAGTGCTGCGACATTTGAGCGT |
You can find this miRNA in ENTREZGENE: MIR372 (accession: 100316464) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |