Basic information from miRBase |
hairpin accession number: MI0003071 |
Located between position 99946878 and 99946957 on chromosome 7 strand - |
Overlapping with sense strand of (intron 14). |
(Ensemble: ENSPTRT00000036049) |
mature miRNAs for MI0003071: |
ptr-miR-93 (MIMAT0002770): AAAGTGCTGTTCGTGCAGGTAG |
You can find this miRNA in EMBL: AY866338 (accession: AY866338) |
References |
[1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |