| Basic information from miRBase |
| hairpin accession number: MI0008778 |
| Located between position 193548247 and 193548342 on chromosome 2b strand + |
| Overlapping with sense strand of XM_001163013.1 (intron 1). |
| (Ensemble: ENSPTRT00000046280) |
| mature miRNAs for MI0008778: |
| ptr-miR-561 (MIMAT0008241): AAAGTTTAAGATCCTTGAAGTT |
| You can find this miRNA in ENTREZGENE: MIR561 (accession: 100316347) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |