| Basic information from miRBase |
| hairpin accession number: MI0008582 |
| Located between position 57317426 and 57317506 on chromosome 2a strand - |
| mature miRNAs for MI0008582: |
| ptr-miR-216b (MIMAT0008072): AAATCTCTGCAGGCAAATGTGA |
| You can find this miRNA in ENTREZGENE: MIR216B (accession: 100316122) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |