| Basic information from miRBase |
| hairpin accession number: MI0007938 |
| Located between position 182150510 and 182150597 on chromosome 2 strand + |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSMMUT00000045251) |
| mature miRNAs for MI0007938: |
| mml-miR-944 (MIMAT0006543): AAATTATTGTATATCAGATGAG |
| You can find this miRNA in ENTREZGENE: MIR944 (accession: 100315367) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |