| Basic information from miRBase |
| hairpin accession number: MI0008635 |
| Located between position 49935210 and 49935273 on chromosome X strand + |
| mature miRNAs for MI0008635: |
| ptr-miR-362 (MIMAT0008116): AACACACCTATTCAAGGATTCA |
| You can find this miRNA in ENTREZGENE: MIR362 (accession: 100316150) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |