| Basic information from miRBase |
| hairpin accession number: MI0008620 |
| Located between position 101457617 and 101457695 on chromosome 14 strand + |
| mature miRNAs for MI0008620: |
| ptr-miR-329 (MIMAT0008101): AACACACCTGGTTAACCTCTTT |
| You can find this miRNA in ENTREZGENE: MIR329-2 (accession: 100316460) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |