| Basic information from miRBase |
| hairpin accession number: MI0015612 |
| Located between position 663351 and 663400 on chromosome scaffold_65 strand + |
| mature miRNAs for MI0015612: |
| cin-miR-4061-5p (MIMAT0016610): AGGCGGTCCCTCAGATGGTT |
| cin-miR-4061-3p (MIMAT0016611): AACACTCTGGCGTTCCGTCA |
| You can find this miRNA in ENTREZGENE: mir4061 (accession: 100498930) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |