miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012858
Located between position 25813224 and 25813346 on chromosome 22 strand +
Overlapping with sense strand of LOC100069423 (intron 18).
(Ensemble: ENSECAT00000018068)
mature miRNAs for MI0012858:
         eca-miR-499-5p (MIMAT0013108): TTAAGACTTGCAGTGATGTTT
         eca-miR-499-3p (MIMAT0013109): AACATCACAGCAAGTCTGTGCT
You can find this miRNA in ENTREZGENE: MIR499 (accession: 100314888)

References
[1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach"