| Basic information from miRBase |
| hairpin accession number: MI0002807 |
| Located between position 124391722 and 124391831 on chromosome 9 strand + |
| Overlapping with antisense strand of A2T6X3_PANTR (intron 2). |
| (Ensemble: ENSPTRT00000061758) |
| mature miRNAs for MI0002807: |
| ptr-miR-181a (MIMAT0002505): AACATTCAACGCTGTCGGTGAGT |
| You can find this miRNA in EMBL: AY866166 (accession: AY866166) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |