| Basic information from miRBase |
| hairpin accession number: MI0008556 |
| Located between position 124392986 and 124393073 on chromosome 9 strand + |
| Overlapping with antisense strand of A2T6X3_PANTR (intron 2). |
| (Ensemble: ENSPTRT00000061758) |
| mature miRNAs for MI0008556: |
| ptr-miR-181b (MIMAT0002625): AACATTCATTGCTGTCGGTGGGT |
| You can find this miRNA in ENTREZGENE: MIR181B-2 (accession: 100316321) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |