| Basic information from miRBase |
| hairpin accession number: MI0008557 |
| Located between position 14274132 and 14274267 on chromosome 19 strand + |
| mature miRNAs for MI0008557: |
| ptr-miR-181d (MIMAT0008049): AACATTCATTGTTGTCGGTGGGT |
| You can find this miRNA in ENTREZGENE: MIR181D (accession: 100316375) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |