miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011198
Located between position 2088313 and 2088432 on chromosome Ppa_Contig0 strand +
mature miRNAs for MI0011198:
         ppc-miR-54 (MIMAT0011695): AACCCGTAATGATAATAATTCGCG

References
[1]de Wit E, Linsen SE, Cuppen E, Berezikov E, Genome Res. 19:2064-2074(2009)., "Repertoire and evolution of miRNA genes in four divergent nematode species"