miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0004751

Located between position 20136963 and 20137043 on chromosome 1 strand -

mature miRNAs for MI0004751:

bta-miR-99a (MIMAT0003537): AACCCGTAGATCCGATCTTGT

bta-miR-99a* (MIMAT0012533): CAAGCTCGCTTCTATGGGT

You can find this miRNA in ENTREZGENE: MIR99A (accession: 790991)

References

[1]Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"

[2]Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M, Mol Reprod Dev. 76:665-677(2009)., "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach"

[3]Long JE, Chen HX, Biochem Genet. 47:329-343(2009)., "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning"