| Basic information from miRBase |
| hairpin accession number: MI0002703 |
| Located between position 16639004 and 16639084 on chromosome 21 strand + |
| Overlapping with sense strand of (intron 5). |
| (Ensemble: ENSPTRT00000060614) |
| mature miRNAs for MI0002703: |
| ptr-miR-99a (MIMAT0002411): AACCCGTAGATCCGATCTTGTG |
| You can find this miRNA in EMBL: AY866054 (accession: AY866054) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |