miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0017313
Located between position 121137484 and 121137555 on chromosome 10 strand +
Overlapping with sense strand of GRK5-002 (intron 2).
(Ensemble: OTTHUMT00000050652)
mature miRNAs for MI0017313:
         hsa-miR-4681 (MIMAT0019766): AACGGGAATGCAGGCTGTATCT

References
[1]Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"