| Basic information from miRBase |
| hairpin accession number: MI0007796 |
| Located between position 59857036 and 59857116 on chromosome 19 strand + |
| mature miRNAs for MI0007796: |
| mml-miR-519b (MIMAT0006385): AACGTGCATCCCTTTAGAGGGTT |
| You can find this miRNA in ENTREZGENE: MIR519B (accession: 100315289) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |