miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0003698
Located between position 759453 and 759535 on chromosome 14 strand +
Overlapping with sense strand of (intron 2).
(Ensemble: ENSGALT00000004821)
mature miRNAs for MI0003698:
         gga-miR-193b (MIMAT0003353): AACTGGCCCACAAAGTCCCGCTTT
You can find this miRNA in ENTREZGENE: MIR193B (accession: 777896)

References
None


more data
Data from CoGemiR