| Basic information from miRBase |
| hairpin accession number: MI0008567 |
| Located between position 14731946 and 14732027 on chromosome 16 strand + |
| mature miRNAs for MI0008567: |
| ptr-miR-193b (MIMAT0008059): AACTGGCCCTCAAAGTCCCGCT |
| You can find this miRNA in ENTREZGENE: MIR193B (accession: 100316114) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |