miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0014855
Located between position 26401697 and 26401784 on chromosome 17 strand +
mature miRNAs for MI0014855:
         ppy-miR-193a-5p (MIMAT0015787): TGGGTCTTTGCGGGCGAGATGA
         ppy-miR-193a-3p (MIMAT0015788): AACTGGCCTACAAAGTCCCAGT

References
[1]Brameier M, BMC Res Notes. 3:64(2010)., "Genome-wide comparative analysis of microRNAs in three non-human primates"