Basic information from miRBase |
hairpin accession number: MI0008566 |
Located between position 25713110 and 25713196 on chromosome 17 strand - |
mature miRNAs for MI0008566: |
ptr-miR-193a (MIMAT0008058): AACTGGCCTACAAAGTCCCAGT |
You can find this miRNA in ENTREZGENE: MIR193A (accession: 100316376) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |