| Basic information from miRBase |
| hairpin accession number: MI0002467 |
| Located between position 2155364 and 2155439 on chromosome 11 strand - |
| Overlapping with sense strand of RP11-889I17.1-002 (intron 5). |
| (Ensemble: OTTHUMT00000026061) |
| mature miRNAs for MI0002467: |
| hsa-miR-483-5p (MIMAT0004761): AAGACGGGAGGAAAGAAGGGAG |
| hsa-miR-483-3p (MIMAT0002173): TCACTCCTCTCCTCCCGTCTT |
| You can find this miRNA in HGNC: MIR483 (accession: 32340) |
| References | ||||||||||||||
[1]Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X, FEBS Lett. 579:3849-3854(2005)., "Identification of human fetal liver miRNAs by a novel method"  | ||||||||||||||
| [2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 149 | chr11, 2116071-2116271, - | promoter sequence | Marson et al. |  | | |||||||||
| 150 | chr11, 2118637-2118837, - | promoter sequence | Marson et al. | | | |||||||||
| 151 | chr11, 2125516-2125716, - | promoter sequence | Marson et al. | | | |||||||||
| 901 | chr11, 2111940-2117015, - | promoter sequence | UCSC | | | |||||||||
This microRNA is imprinted (based on ncRNAimprinted database) |
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |