miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006224
Located between position 330020 and 330419 on chromosome scaffold_31 strand +
mature miRNAs for MI0006224:
         cre-miR1163.2 (MIMAT0005417): AGGGCATGCTGCGTGCCATGG
         cre-miR1163.1 (MIMAT0005418): AAGAGCGCCATGGCACGCAGC

References
[1]Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC, Nature. 447:1126-1129(2007)., "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii"