| Basic information from miRBase |
| hairpin accession number: MI0009966 |
| Located between position 73449424 and 73449517 on chromosome 8 strand + |
| mature miRNAs for MI0009966: |
| mmu-miR-1969 (MIMAT0009442): AAGATGGAGACTTTAACATGGGT |
| You can find this miRNA in MGI: Mir1969 (accession: 3837216) |
| References |
| [1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model" |