| Basic information from miRBase |
| hairpin accession number: MI0008787 |
| Located between position 112930411 and 112930507 on chromosome 4 strand + |
| Overlapping with sense strand of (intron 3). |
| (Ensemble: ENSPTRT00000063974) |
| mature miRNAs for MI0008787: |
| ptr-miR-576 (MIMAT0008250): AAGATGTGGAAAAATTGGAATC |
| You can find this miRNA in ENTREZGENE: MIR576 (accession: 100316231) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |