| Basic information from miRBase |
| hairpin accession number: MI0008414 |
| Located between position 86319573 and 86319662 on chromosome 15 strand + |
| mature miRNAs for MI0008414: |
| ptr-miR-1179 (MIMAT0007948): AAGCATTCTTTCATTGGTTGG |
| You can find this miRNA in ENTREZGENE: MIR1179 (accession: 100316041) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |