| Basic information from miRBase |
| hairpin accession number: MI0012789 |
| Located between position 8530962 and 8531035 on chromosome 12 strand + |
| mature miRNAs for MI0012789: |
| eca-miR-129b-5p (MIMAT0013045): CTTTTTGCGGTCTGGGCTTGC |
| eca-miR-129b-3p (MIMAT0013046): AAGCCCTTACCCCAAAAAGCAT |
| You can find this miRNA in ENTREZGENE: MIR129B (accession: 100314977) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |