miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013169
Located between position 17100324 and 17100403 on chromosome 2 strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSSSCT00000020716)
mature miRNAs for MI0013169:
         ssc-miR-129a (MIMAT0013959): AAGCCCTTACCCCAAAAAGCAT
You can find this miRNA in ENTREZGENE: MIR129 (accession: 100498751)

References
[1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"
[2]Li G, Li Y, Li X, Ning X, Li M, Yang G, J Cell Biochem. 112:1318-1328(2011)., "MicroRNA identity and abundance in developing swine adipose tissue as determined by solexa sequencing"