| Basic information from miRBase |
| hairpin accession number: MI0007618 |
| Located between position 165758238 and 165758309 on chromosome 3 strand + |
| mature miRNAs for MI0007618: |
| mml-miR-129-5p (MIMAT0006185): CTTTTTGCGGTCTGGGCTTGC |
| mml-miR-129-3p (MIMAT0006186): AAGCCCTTACCCCAAAAAGTAT |
| You can find this miRNA in ENTREZGENE: MIR129 (accession: 100315194) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |