miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0017301
Located between position 95290266 and 95290340 on chromosome 9 strand -
Overlapping with sense strand of ECM2-003 (intron 2).
(Ensemble: OTTHUMT00000053093)
mature miRNAs for MI0017301:
         hsa-miR-4670-5p (MIMAT0019750): AAGCGACCATGATGTAACTTCA
         hsa-miR-4670-3p (MIMAT0019751): TGAAGTTACATCATGGTCGCTT

References
[1]Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"