| Basic information from miRBase |
| hairpin accession number: MI0002650 |
| Located between position 194291274 and 194291359 on chromosome 3 strand + |
| Overlapping with sense strand of XM_001159438.1 (intron 6). |
| (Ensemble: ENSPTRT00000029319) |
| mature miRNAs for MI0002650: |
| ptr-miR-28 (MIMAT0002353): AAGGAGCTCACAGTCTATTGAG |
| You can find this miRNA in EMBL: AY865988 (accession: AY865988) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |