miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008887
Located between position 2373309 and 2373401 on chromosome 16 strand +
mature miRNAs for MI0008887:
         ptr-miR-940 (MIMAT0008347): AAGGCAGGGCCCCCGCTCCCC
You can find this miRNA in ENTREZGENE: MIR940 (accession: 100316285)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"