| Basic information from miRBase |
| hairpin accession number: MI0008887 |
| Located between position 2373309 and 2373401 on chromosome 16 strand + |
| mature miRNAs for MI0008887: |
| ptr-miR-940 (MIMAT0008347): AAGGCAGGGCCCCCGCTCCCC |
| You can find this miRNA in ENTREZGENE: MIR940 (accession: 100316285) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |